Summary for the 418-th Site(K)

PID QueryLength FocusSite TITLE
2752856 925 418 K RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 418-th site DOMAIN: /note="Helicase ATP-binding"
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
K:25% S:18% R:11% D:11% E:10% T:6% G:4% L:3% V:3% Q:2% A:1% N:1% I:1% F:1% P:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs (coil) e (exposed) 67.0
3D Complex Information
Predicted Bind Molecules
homo:12 nucleotide:5
Templates for 3D complexes
homo [94569:DDX58_HUMAN ] 5f98_A_1_E_1 5f98_E_1_A_1 5f9f_A_1_E_1 5f9f_E_1_A_1 5f9h_A_1_E_1 5f9h_E_1_A_1 7jl3_A_1_E_1 7jl3_C_1_A_1 8g7t_A_1_C_1 8g7t_C_1_A_1 8g7u_A_1_C_1 8g7v_A_1_C_1 nucleotide [ggaucgaucgaucxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgaucgaucgaucc ] 8dvs_A_1_B_1 [xxxxxgaucgaucgaucggcaucxxxxxxxxxxxxxxxxxxgaugccgaucgaucgaucxxxxx ] 8dvu_A_1_B_1 [Xcuacagucgcgaaacguacguccxxxx ] 8g7t_A_1_F_1 [Xgacguacguuucgcgacuguagaxxxx ] 8g7t_C_1_E_1 [Xgaucgaucgaucgaucggcaucgaucggcxxxxgccgaucgaugccgaucgaucgaucgauccxxxx ] 8scz_A_1_B_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]