Summary for the 890-th Site(E) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 890 E | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 890-th site |
HELIX: DOMAIN: /note="RLR CTR" REGION: /note="Mediates interaction with RNF135" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
R:45% E:40% G:15% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7to0 | G (3/10-helix) | e (exposed) | 56.3 |
Predicted Bind Molecules |
nucleotide:5 metal:2 |
Templates for 3D complexes |
nucleotide [gcgcgcgcgc ] 3zd7_A_1_B_1 [gaauauaauagugauauuauauuc ] 5f98_G_1_H_1 [atctcXgXgXcaXgXgXXXXaaXgXcagXXXaaXgaXgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7mk1_A_1_C_1 7mk1_B_1_D_1 [xxxxxgaucgaucgaucggcxxxxxxxxxxxxxxxxxxxxxxxxgccgaucgaucgaucxxxxxxxxx ] 7to2_A_1_B_1 metal [MG ] 7mk1_A_1_F_1 7mk1_B_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |