Summary for the 878-th Site(K)

PID QueryLength FocusSite TITLE
2752856 925 878 K RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 878-th site STRAND:
DOMAIN: /note="RLR CTR"
REGION: /note="Mediates interaction with RNF135"
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
I:31% V:29% R:27% K:13% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7to0 E (beta-strand) e (exposed) 34.4
3D Complex Information
Predicted Bind Molecules
homo:7 nucleotide:12
Templates for 3D complexes
homo [96250:DDX58_HUMAN ] 5f9f_C_1_A_1 5f9f_I_1_E_1 5f9h_A_1_C_1 5f9h_C_1_A_1 5f9h_I_1_E_1 [99924:IFIH1_HUMAN ] 7jl2_C_1_G_1 7jl2_E_1_C_1 nucleotide [agggccgcggau ] 4gl2_A_1_F_1 4gl2_B_1_E_1 [ucagucagucaguc ] 7jl0_C_1_B_1 7jl1_A_1_C_1 [ucagucagucagucuucagucagucagucuucagucagucaguc ] 7jl2_C_1_B_1 7jl2_E_1_B_1 [ucagucagucagucucagucagucagucucagucagucaguc ] 7jl3_A_1_H_1 7jl3_C_1_H_1 7jl3_E_1_H_1 [xxxxxgaucgaucgaucggcxxxxxxxxxxxxxxxxxxxxxxxxgccgaucgaucgaucxxxxxxxxx ] 7to2_A_1_B_1 [xxxxxgaucgaucgaucggcaucxxxxxxxxxxxxxxxxxxgaugccgaucgaucgaucxxxxx ] 8dvu_A_1_B_1 [xcuacagucgcgaaacguacguccxxxx ] 8g7v_C_1_F_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]