Summary for the 872-nd Site(D) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 872 D | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 872-th site |
STRAND: DOMAIN: /note="RLR CTR" REGION: /note="Mediates interaction with RNF135" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
D:40% V:31% A:29% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7to0 | B (beta-bridge) | e (exposed) | 21.0 |
Predicted Bind Molecules |
nucleotide:11 compound:11 precipitant:1 |
Templates for 3D complexes |
nucleotide [Xgcgcgcgcgcgccxxxx ] 3lrn_A_1_C_1 3lrn_B_1_D_1 [Xuauauauauauxxxx ] 3lrr_A_1_C_1 3lrr_B_1_D_1 [Xgcgcggcuucggccgcgccxxxx ] 4ay2_A_1_B_1 [gaauauaauagugauauuauauuc ] 5f98_C_1_D_1 5f98_I_1_J_1 [Xgacguacgucgxxxxxxxxxxxxxxxx ] 7tnz_A_1_B_1 [Xgacguacguuucgcgacuguagaxxxx ] 8g7t_A_1_E_1 [Xgaucgaucgaucgaucggcaucgaucggcxxxxgccgaucgaugccgaucgaucgaucgauccxxxx ] 8scz_A_1_B_1 [Xgaucgaucgaucguucgcgaucgaucgauccxxxx ] 8sd0_A_1_B_1 compound [M7G ] 5f98_A_1_O_1 5f98_E_1_U_1 5f98_I_1_AA_1 5f98_K_1_DA_1 [GTP ] 5f9h_A_1_Q_1 5f9h_C_1_S_1 5f9h_E_1_V_1 5f9h_G_1_Z_1 5f9h_I_1_CA_1 5f9h_K_1_FA_1 8dvr_A_1_D_1 precipitant [ETF ] 5f9f_E_1_Y_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |