Summary for the 801-st Site(P)
PID QueryLength FocusSite TITLE
2752856 925 801 P RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 801-th site STRAND:
DOMAIN: /note="RLR CTR"
REGION: /note="Mediates interaction with RNF135"
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
P:57% S:13% N:8% Q:8% K:8% A:1% G:1% L:1%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs (coil) e (exposed) 50.4
3D Complex Information
Predicted Bind Molecules
nucleotide:3
Templates for 3D complexes
nucleotide [ucagucagucagucuucagucagucagucuucagucagucaguc ] 7jl2_C_1_B_1 7jl2_E_1_B_1 7jl2_G_1_B_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]