Summary for the 719-th Site(G)

PID QueryLength FocusSite TITLE
2752856 925 719 G RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 719-th site DOMAIN: /note="Helicase C-terminal"
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
K:16% S:16% N:12% T:12% A:11% R:7% G:6% P:6% L:4% D:3% E:3% Q:1% H:1% V:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs (coil) e (exposed) 39.3
3D Complex Information
Predicted Bind Molecules
homo:1 nucleotide:7 precipitant:2
Templates for 3D complexes
homo [94569:DDX58_HUMAN ] 4on9_B_1_A_1 nucleotide [auccgcggcccu ] 4gl2_A_1_C_1 4gl2_B_1_D_1 [gaauauaauagugauauuauauuc ] 5f98_E_1_F_1 [Xgacguacgucgxxxxxxxxxxxxxxxx ] 7tny_A_1_B_1 [xxxxxgaucgaucgaucggcxxxxxxxxxxxxxxxxxxxxxxxxgccgaucgaucgaucxxxxxxxxx ] 7to2_A_1_B_1 [ggaucgaucgaucxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgaucgaucgaucc ] 8dvs_A_1_B_1 [xxxxxgaucgaucgaucggcaucxxxxxxxxxxxxxxxxxxgaugccgaucgaucgaucxxxxx ] 8dvu_A_1_B_1 precipitant [BU3 ] 5f9f_E_1_AA_1 5f9f_G_1_FA_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]