Summary for the 700-th Site(A) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 700 A | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 700-th site |
MUTAGEN: /note="TSVAD->ASVAA: No effect on dsRNA-induced ATPase activity. Changed RIG-I signaling pathway." STRAND: DOMAIN: /note="Helicase C-terminal" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
A:37% L:32% G:24% V:4% S:2% T:2% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7to0 | G (3/10-helix) | b (buried) | 2.7 |
Predicted Bind Molecules |
nucleotide:22 precipitant:1 |
Templates for 3D complexes |
nucleotide [gaauauaauagugauauuauauuc ] 5f98_A_1_B_1 5f98_C_1_D_1 5f98_E_1_F_1 5f98_G_1_H_1 5f98_I_1_J_1 5f98_K_1_L_1 5f9f_A_1_B_1 5f9f_C_1_D_1 5f9f_E_1_F_1 5f9f_G_1_H_1 5f9f_I_1_J_1 5f9f_K_1_L_1 [aauauaauagugauauuauauuc ] 5f9h_A_1_B_1 5f9h_C_1_D_1 5f9h_E_1_F_1 5f9h_G_1_H_1 5f9h_I_1_J_1 5f9h_K_1_L_1 [xgacgcuagcgucg ] 6gpg_C_1_B_1 [gguagacgcuucggcguuugcc ] 6kyv_B_1_A_1 6kyv_H_1_G_1 6kyv_L_1_K_1 precipitant [BU3 ] 5f9f_C_1_V_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |