Summary for the 672-nd Site(G) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 672 G | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 672-th site |
DOMAIN: /note="Helicase C-terminal" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
G:35% E:14% D:9% A:6% N:5% L:5% Q:4% S:4% K:3% F:3% P:3% H:2% V:2% R:1% I:1% T:1% Y:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7to0 | S (bend) | e (exposed) | 38.1 |
Predicted Bind Molecules |
nucleotide:3 |
Templates for 3D complexes |
nucleotide [gacugacugacugaagacugacugacugaagacugacugacuga ] 7jl2_C_1_A_1 7jl2_E_1_A_1 7jl2_G_1_A_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |