Summary for the 331-st Site(N)

PID QueryLength FocusSite TITLE
2752856 925 331 N RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 331-th site STRAND:
DOMAIN: /note="Helicase ATP-binding"
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
Q:15% D:12% S:11% G:10% K:10% N:7% E:7% R:6% T:6% M:5% H:3% L:3% A:2% P:1% V:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7to0 S (bend) e (exposed) 94.5
3D Complex Information
Predicted Bind Molecules
homo:3 nucleotide:2
Templates for 3D complexes
homo [99924:IFIH1_HUMAN ] 7jl2_C_1_G_1 7jl2_E_1_C_1 [96250:DDX58_HUMAN ] 8g7v_C_1_A_1 nucleotide [gacugacugacugaagacugacugacugaagacugacugacuga ] 7jl2_C_1_A_1 7jl2_E_1_A_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]