|
|
| PID | QueryLength | FocusSite | TITLE |
| 2752856 | 925 | 890 E | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
| AC/ID | AC:O95786 ID:RIGI_HUMAN |
| Feature Table for 890-th site |
HELIX: DOMAIN: /note="RLR CTR" REGION: /note="Mediates interaction with RNF135" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins
 [show alignment]
|
R:45% E:40% G:15% |
| Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
 8dvs |
G (3/10-helix) | e (exposed) | 49.7 |
| Predicted Bind Molecules |
| nucleotide:4 metal:2 |
| Templates for 3D complexes |
|
nucleotide [gaauauaauagugauauuauauuc ] 5f98_G_1_H_1 [atctcXgXgXcaXgXgXXXXaaXgXcagXXXaaXgaXgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7mk1_A_1_C_1 7mk1_B_1_D_1 [xxxxxgaucgaucgaucggcxxxxxxxxxxxxxxxxxxxxxxxxgccgaucgaucgaucxxxxxxxxx ] 7to2_A_1_B_1
metal [MG ] 7mk1_A_1_F_1 7mk1_B_1_H_1
|
 [Back to SiteTable] |
 [Back to Search Page] |
 [Back to Top Page] |
Summary for the 890-th Site(E)