|
|
| PID | QueryLength | FocusSite | TITLE |
| 2752856 | 925 | 878 K | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
| AC/ID | AC:O95786 ID:RIGI_HUMAN |
| Feature Table for 878-th site |
STRAND: DOMAIN: /note="RLR CTR" REGION: /note="Mediates interaction with RNF135" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins
 [show alignment]
|
I:31% V:29% R:27% K:13% |
| Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
 8dvs |
E (beta-strand) | e (exposed) | 24.5 |
| Predicted Bind Molecules |
| homo:5 nucleotide:7 |
| Templates for 3D complexes |
|
homo [94569:DDX58_HUMAN
] 5f9f_C_1_A_1 5f9f_I_1_E_1 5f9h_A_1_C_1 5f9h_C_1_A_1 5f9h_I_1_E_1
nucleotide [ucagucagucaguc ] 7jl1_A_1_C_1 [ucagucagucagucucagucagucagucucagucagucaguc ] 7jl3_A_1_H_1 7jl3_C_1_H_1 7jl3_E_1_H_1 [xxxxxgaucgaucgaucggcxxxxxxxxxxxxxxxxxxxxxxxxgccgaucgaucgaucxxxxxxxxx ] 7to2_A_1_B_1 [xxxxxgaucgaucgaucggcaucxxxxxxxxxxxxxxxxxxgaugccgaucgaucgaucxxxxx ] 8dvu_A_1_B_1 [xcuacagucgcgaaacguacguccxxxx ] 8g7v_C_1_F_1
|
 [Back to SiteTable] |
 [Back to Search Page] |
 [Back to Top Page] |
Summary for the 878-th Site(K)