Summary for the 678-th Site(Q)

PID QueryLength FocusSite TITLE
2752856 925 678 Q RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 678-th site HELIX:
DOMAIN: /note="Helicase C-terminal"
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
Q:68% R:19% M:6% D:3% S:2% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs H (alpha-helix) b (buried) 2.0
3D Complex Information
Predicted Bind Molecules
nucleotide:13
Templates for 3D complexes
nucleotide [xxacgcuagcgucg ] 5e3h_A_1_C_1 [gaauauaauagugauauuauauuc ] 5f9f_E_1_F_1 5f9f_G_1_H_1 5f9f_I_1_J_1 [gguagacgcuucggcguuugcc ] 6kyv_B_1_A_1 6kyv_D_1_C_1 6kyv_F_1_E_1 6kyv_H_1_G_1 6kyv_J_1_I_1 6kyv_L_1_K_1 [xxxxxxxxxxxxcgacguacguccxxxx ] 7tny_A_1_C_1 [xxxxxgaucgaucgaucggcxxxxxxxxxxxxxxxxxxxxxxxxgccgaucgaucgaucxxxxxxxxx ] 7to2_A_1_B_1 [xxxxxgaucgaucgaucggcaucxxxxxxxxxxxxxxxxxxgaugccgaucgaucgaucxxxxx ] 8dvu_A_1_B_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]