Summary for the 879-th Site(Y) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 879 Y | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 879-th site |
STRAND: DOMAIN: /note="RLR CTR" REGION: /note="Mediates interaction with RNF135" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
Y:71% H:29% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8dvs | S (bend) | b (buried) | 17.4 |
Predicted Bind Molecules |
nucleotide:6 |
Templates for 3D complexes |
nucleotide [ucagucagucaguc ] 7jl1_A_1_C_1 [ucagucagucagucucagucagucagucucagucagucaguc ] 7jl3_A_1_H_1 7jl3_C_1_H_1 [xxxxxgaucgaucgaucggcxxxxxxxxxxxxxxxxxxxxxxxxgccgaucgaucgaucxxxxxxxxx ] 7to2_A_1_B_1 [xxxxxgaucgaucgaucggcaucxxxxxxxxxxxxxxxxxxgaugccgaucgaucgaucxxxxx ] 8dvu_A_1_B_1 [xcuacagucgcgaaacguacguccxxxx ] 8g7v_C_1_F_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |