Summary for the 719-th Site(G) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 719 G | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 719-th site |
DOMAIN: /note="Helicase C-terminal" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
K:16% S:16% N:12% T:12% A:11% R:7% G:6% P:6% L:4% D:3% E:3% Q:1% H:1% V:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8dvs | (coil) | e (exposed) | 39.3 |
Predicted Bind Molecules |
homo:1 nucleotide:5 precipitant:2 |
Templates for 3D complexes |
homo [94569:DDX58_HUMAN ] 4on9_B_1_A_1 nucleotide [gaauauaauagugauauuauauuc ] 5f98_E_1_F_1 [Xgacguacgucgxxxxxxxxxxxxxxxx ] 7tny_A_1_B_1 [xxxxxgaucgaucgaucggcxxxxxxxxxxxxxxxxxxxxxxxxgccgaucgaucgaucxxxxxxxxx ] 7to2_A_1_B_1 [ggaucgaucgaucxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgaucgaucgaucc ] 8dvs_A_1_B_1 [xxxxxgaucgaucgaucggcaucxxxxxxxxxxxxxxxxxxgaugccgaucgaucgaucxxxxx ] 8dvu_A_1_B_1 precipitant [BU3 ] 5f9f_E_1_AA_1 5f9f_G_1_FA_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |