Summary for the 329-th Site(A) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 329 A | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 329-th site |
DOMAIN: /note="Helicase ATP-binding" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
G:16% S:15% A:12% K:10% R:7% Q:6% L:5% W:5% P:4% V:4% H:3% F:3% T:3% N:2% Y:2% E:1% I:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8dvs | (coil) | e (exposed) | 31.2 |
Predicted Bind Molecules |
nucleotide:2 precipitant:1 |
Templates for 3D complexes |
nucleotide [xxacgcuagcgucg ] 5e3h_A_1_C_1 [gaauauaauagugauauuauauuc ] 5f9f_K_1_L_1 precipitant [BU3 ] 5f9f_G_1_EA_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |