Summary for the 422-nd Site(E)

PID QueryLength FocusSite TITLE
2752856 925 422 E RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 422-th site HELIX:
DOMAIN: /note="Helicase ATP-binding"
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
E:29% S:18% Q:11% N:9% D:8% K:6% G:5% A:4% I:4% H:2% T:2% L:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs H (alpha-helix) e (exposed) 42.7
3D Complex Information
Predicted Bind Molecules
nucleotide:1
Templates for 3D complexes
nucleotide [ucagucagucagucuucagucagucagucuucagucagucaguc ] 7jl2_G_1_B_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]