|
|
| PID | QueryLength | FocusSite | TITLE |
| 2752856 | 925 | 378 S | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
| AC/ID | AC:O95786 ID:RIGI_HUMAN |
| Feature Table for 378-th site |
STRAND: DOMAIN: /note="Helicase ATP-binding" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins
 [show alignment]
|
T:25% K:17% S:13% I:10% L:5% N:4% H:4% M:4% P:4% V:4% R:3% Q:3% G:3% C:1% |
| Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
 8dvs |
(coil) | e (exposed) | 37.5 |
| Predicted Bind Molecules |
| nucleotide:5 |
| Templates for 3D complexes |
|
nucleotide [gcaugcgaccucuguuuga ] 4a36_A_1_C_1 [gcaugcgaccucuguuugx ] 4a36_B_1_E_1 [gguagacgcuucggcguuugcc ] 6kyv_D_1_C_1 [Xgacguacgucgxxxxxxxxxxxxxxxx ] 7tnz_A_1_B_1 [ggacguacgucgxxxxxxxxxxxx ] 7to0_A_1_B_1
|
 [Back to SiteTable] |
 [Back to Search Page] |
 [Back to Top Page] |
Summary for the 378-th Site(S)