Summary for the 331-st Site(N) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 331 N | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 331-th site |
STRAND: DOMAIN: /note="Helicase ATP-binding" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
Q:15% D:12% S:11% G:10% K:10% N:7% E:7% R:6% T:6% M:5% H:3% L:3% A:2% P:1% V:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8dvs | S (bend) | e (exposed) | 81.8 |
Predicted Bind Molecules |
homo:3 nucleotide:2 |
Templates for 3D complexes |
homo [98179:IFIH1_HUMAN ] 7jl2_C_1_G_1 7jl2_E_1_C_1 [94569:DDX58_HUMAN ] 8g7v_C_1_A_1 nucleotide [gacugacugacugaagacugacugacugaagacugacugacuga ] 7jl2_C_1_A_1 7jl2_E_1_A_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |