Summary for the 794-th Site(Q)

PID QueryLength FocusSite TITLE
2752856 925 794 Q RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 794-th site DOMAIN: /note="RLR CTR"
REGION: /note="Mediates interaction with RNF135"
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
Q:43% R:15% E:13% W:13% K:8% A:1% G:1% L:1% S:1% T:1% V:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs (coil) e (exposed) 68.4
3D Complex Information
Predicted Bind Molecules
homo:3 nucleotide:4
Templates for 3D complexes
homo [97281:IFIH1_MOUSE ] 7bkq_A_1_A_2 [94569:DDX58_HUMAN ] 8g7u_A_1_C_1 8g7v_A_1_C_1 nucleotide [gguacguacc ] 5jc3_D_1_F_1 5jch_D_1_F_1 [gggacgucaugcgcaugacguccc ] 5jc7_A_1_D_1 [xggacgucaugcgcaugacgucccc ] 5jc7_B_1_C_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]