Summary for the 790-th Site(I)

PID QueryLength FocusSite TITLE
2752856 925 790 I RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 790-th site HELIX:
REGION: /note="Mediates interaction with RNF135"
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
I:25% L:20% M:18% D:12% Q:7% E:7% K:7% A:1% G:1% S:1% V:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs H (alpha-helix) e (exposed) 40.4
3D Complex Information
Predicted Bind Molecules
homo:8 nucleotide:2
Templates for 3D complexes
homo [97432:D9N195_CHICK ] 5jc7_A_1_B_1 5jc7_B_1_A_1 [97281:IFIH1_MOUSE ] 7bkq_A_1_A_2 [98179:IFIH1_HUMAN ] 7jl2_G_1_C_1 [94569:DDX58_HUMAN ] 7jl3_A_1_E_1 7jl3_C_1_A_1 8g7u_A_1_C_1 8g7v_A_1_C_1 nucleotide [ucagucagucagucuucagucagucagucuucagucagucaguc ] 7jl2_C_1_B_1 7jl2_G_1_B_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]