Summary for the 674-th Site(T)
PID QueryLength FocusSite TITLE
2752856 925 674 T RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 674-th site DOMAIN: /note="Helicase C-terminal"
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
T:31% N:16% S:15% D:6% L:6% E:5% K:4% V:4% Q:3% R:2% G:2% H:2% A:1% I:1% P:1%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs (coil) e (exposed) 48.7
3D Complex Information
Predicted Bind Molecules
nucleotide:18
Templates for 3D complexes
nucleotide [caagccgaggagag ] 6g19_A_1_B_1 6gjz_A_1_B_1 6gkm_A_1_B_1 7bkp_A_1_C_1 [uccaugcgcaugacg ] 6g1s_A_1_B_1 6g1x_A_1_B_1 6h61_A_1_B_1 6h66_A_1_B_1 7bkq_A_1_B_1 7bkq_A_2_B_2 7nga_C_1_A_1 [gucaagccgaggaga ] 6gkh_A_1_B_1 7nic_A_1_B_1 [xgaaugaugccuggcucgagaccauucaaucucaugaucucaugauuauxxxgaxgaugxugaugaugucggaccaggcuucauucccc ] 7ele_A_1_B_1 [gacugacugacuga ] 7jl1_A_1_B_1 [caagccgaggagau ] 7niq_A_1_B_1 [xxxxxgaucgaucgaucggcxxxxxxxxxxxxxxxxxxxxxxxxgccgaucgaucgaucxxxxxxxxx ] 7to2_A_1_B_1 [xxxxxgaucgaucgaucggcaucxxxxxxxxxxxxxxxxxxgaugccgaucgaucgaucxxxxx ] 8dvu_A_1_B_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]