Summary for the 672-nd Site(G)

PID QueryLength FocusSite TITLE
2752856 925 672 G RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 672-th site DOMAIN: /note="Helicase C-terminal"
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
G:35% E:14% D:9% A:6% N:5% L:5% Q:4% S:4% K:3% F:3% P:3% H:2% V:2% R:1% I:1% T:1% Y:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs S (bend) e (exposed) 41.7
3D Complex Information
Predicted Bind Molecules
nucleotide:4
Templates for 3D complexes
nucleotide [gacugacugacugaagacugacugacugaagacugacugacuga ] 7jl2_C_1_A_1 7jl2_E_1_A_1 7jl2_G_1_A_1 [gucaagccgaggaga ] 7nic_A_1_B_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]