|
|
| PID | QueryLength | FocusSite | TITLE |
| 2752856 | 925 | 669 Q | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
| AC/ID | AC:O95786 ID:RIGI_HUMAN |
| Feature Table for 669-th site |
STRAND: DOMAIN: /note="Helicase C-terminal" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins
 [show alignment]
|
Q:22% K:15% G:11% R:7% N:6% D:6% I:6% A:5% S:5% E:4% P:4% L:2% T:2% V:2% Y:1% |
| Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
 8dvs |
S (bend) | e (exposed) | 43.4 |
| Predicted Bind Molecules |
| nucleotide:11 precipitant:1 |
| Templates for 3D complexes |
|
nucleotide [gguacguacc ] 5jaj_A_1_C_1 5jc3_A_1_C_1 5jc3_D_1_F_1 5jcf_D_1_F_1 [Xguacguaccxxxx ] 5jb2_A_1_C_1 [Xgagcgugccgxxxggcacgcuccggxxxx ] 5jbg_A_1_B_1 [gguagcgcuacc ] 5jbj_A_1_C_1 [gggacgucaugcgcaugacguccc ] 5jc7_A_1_D_1 [xggacgucaugcgcaugacgucccc ] 5jc7_B_1_C_1 [agguacguacc ] 5jcf_A_1_C_1 [xgaaugaugccuggcucgagaccauucaaucucaugaucucaugauuauxxxgaxgaugxugaugaugucggaccaggcuucauucccc ] 7ele_A_1_B_1
precipitant [ETF ] 5f9f_E_1_Y_1
|
 [Back to SiteTable] |
 [Back to Search Page] |
 [Back to Top Page] |
Summary for the 669-th Site(Q)