Summary for the 491-st Site(K)

PID QueryLength FocusSite TITLE
2752856 925 491 K RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 491-th site REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
K:37% E:16% R:10% G:7% N:6% L:4% V:4% D:3% Q:3% P:3% M:2% A:1% I:1% F:1% S:1% T:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs T (Hbond turn) e (exposed) 77.8
3D Complex Information
Predicted Bind Molecules
homo:5 nucleotide:3
Templates for 3D complexes
homo [94569:DDX58_HUMAN ] 4on9_A_1_B_1 4on9_B_1_A_1 [97432:D9N195_CHICK ] 5jc7_A_1_B_1 5jc7_B_1_A_1 [97281:IFIH1_MOUSE ] 7bkq_A_1_A_2 nucleotide [xggacgucaugcgcaugacgucccc ] 5jc7_A_1_C_1 [gggacgucaugcgcaugacguccc ] 5jc7_B_1_D_1 [uccaugcgcaugacg ] 7bkq_A_1_B_2


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]