Summary for the 333-rd Site(P)

PID QueryLength FocusSite TITLE
2752856 925 333 P RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 333-th site DOMAIN: /note="Helicase ATP-binding"
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
R:15% P:13% W:12% S:9% A:8% T:6% Q:5% G:5% L:5% H:4% V:4% D:3% E:3% I:2% N:1% C:1% K:1% F:1% Y:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs (coil) e (exposed) 37.2
3D Complex Information
Predicted Bind Molecules
homo:23 nucleotide:3
Templates for 3D complexes
homo [94569:DDX58_HUMAN ] 5f98_A_1_C_1 5f98_C_1_A_1 5f98_E_1_I_1 5f98_G_1_K_1 5f98_I_1_E_1 5f98_K_1_G_1 5f9f_A_1_C_1 5f9f_C_1_A_1 5f9f_E_1_I_1 5f9f_G_1_K_1 5f9f_I_1_E_1 5f9f_K_1_G_1 5f9h_A_1_C_1 5f9h_C_1_A_1 5f9h_E_1_I_1 5f9h_G_1_K_1 5f9h_I_1_E_1 5f9h_K_1_G_1 7jl3_A_1_C_1 7jl3_E_1_A_1 8g7v_C_1_A_1 [98179:IFIH1_HUMAN ] 7jl2_C_1_G_1 7jl2_E_1_C_1 nucleotide [Xgagcgugccgxxxggcacgcuccggxxxx ] 5jbg_A_1_B_1 [gacctgctgcggattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5v9x_A_1_B_1 [xxxxxxxugagccaaaaguucaggugaaugaugccuggcucgagaccauucaaucucaugxxxxxxxxxxuauxxxgaxgaugxugaugaugucggaccaggcuucauuccccucaacuuxxxxxxxuugcxxcucaaucxxxxxxxx ] 7eld_A_1_B_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]