Summary for the 324-th Site(I)

PID QueryLength FocusSite TITLE
2752856 925 324 I RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 324-th site STRAND:
DOMAIN: /note="Helicase ATP-binding"
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
L:34% I:17% V:10% A:9% M:5% S:5% D:4% F:4% Q:3% Y:3% G:2% T:2% E:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs (coil) b (buried) 2.3
3D Complex Information
Predicted Bind Molecules
hetero:3 homo:5 nucleotide:3
Templates for 3D complexes
hetero [66870:G0SFL3_CHATD ] 5m59_D_1_C_1 5m59_F_1_E_1 5m59_H_1_G_1 homo [94569:DDX58_HUMAN ] 5f98_C_1_A_1 5f98_E_1_I_1 5f98_G_1_K_1 5f9f_G_1_K_1 5f9h_G_1_K_1 nucleotide [Xgagcgugccgxxxggcacgcuccggxxxx ] 5jbg_A_1_B_1 [xxxxxxxugagccaaaaguucaggugaaugaugccuggcucgagaccauucaaucucaugxxxxxxxxxxuauxxxgaxgaugxugaugaugucggaccaggcuucauuccccucaacuuxxxxxxxuugcxxcucaaucxxxxxxxx ] 7eld_A_1_B_1 [xgaaugaugccuggcucgagaccauucaaucucaugaucucaugauuauxxxgaxgaugxugaugaugucggaccaggcuucauucccc ] 7ele_A_1_B_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]