Summary for the 322-nd Site(T)

PID QueryLength FocusSite TITLE
2752856 925 322 T RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 322-th site STRAND:
DOMAIN: /note="Helicase ATP-binding"
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
T:16% A:15% K:10% C:8% G:8% S:8% V:6% I:5% L:5% Q:4% F:4% R:3% E:3% Y:2% D:1% W:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs E (beta-strand) e (exposed) 21.4
3D Complex Information
Predicted Bind Molecules
homo:18 nucleotide:1
Templates for 3D complexes
homo [94569:DDX58_HUMAN ] 5f98_A_1_C_1 5f98_C_1_A_1 5f98_E_1_I_1 5f98_G_1_K_1 5f98_I_1_E_1 5f98_K_1_G_1 5f9f_A_1_C_1 5f9f_C_1_A_1 5f9f_E_1_I_1 5f9f_G_1_K_1 5f9f_I_1_E_1 5f9f_K_1_G_1 5f9h_A_1_C_1 5f9h_C_1_A_1 5f9h_E_1_I_1 5f9h_G_1_K_1 5f9h_I_1_E_1 5f9h_K_1_G_1 nucleotide [xxxxxxxugagccaaaaguucaggugaaugaugccuggcucgagaccauucaaucucaugxxxxxxxxxxuauxxxgaxgaugxugaugaugucggaccaggcuucauuccccucaacuuxxxxxxxuugcxxcucaaucxxxxxxxx ] 7eld_A_1_B_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]