Summary for the 887-th Site(I) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 887 I | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 887-th site |
STRAND: DOMAIN: /note="RLR CTR" REGION: /note="Mediates interaction with RNF135" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
L:60% I:40% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8dvs | E (beta-strand) | b (buried) | 5.3 |
Predicted Bind Molecules |
nucleotide:13 |
Templates for 3D complexes |
nucleotide [cgacgcuagcguxx ] 5e3h_A_1_B_1 [gaauauaauagugauauuauauuc ] 5f98_I_1_J_1 5f9f_E_1_F_1 5f9f_G_1_H_1 5f9f_K_1_L_1 [gguagacgcuucggcguuugcc ] 6kyv_D_1_C_1 6kyv_F_1_E_1 6kyv_H_1_G_1 6kyv_J_1_I_1 6kyv_L_1_K_1 [gacgcuagcguc ] 7bah_A_1_C_1 7bah_B_1_D_1 [Xgaucgaucgaucguucgcgaucgaucgauccxxxx ] 8sd0_A_1_B_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |