Summary for the 872-nd Site(D)

PID QueryLength FocusSite TITLE
2752856 925 872 D RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 872-th site STRAND:
DOMAIN: /note="RLR CTR"
REGION: /note="Mediates interaction with RNF135"
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
D:40% V:31% A:29% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs B (beta-bridge) e (exposed) 23.5
3D Complex Information
Predicted Bind Molecules
nucleotide:6 compound:11 precipitant:1
Templates for 3D complexes
nucleotide [gaauauaauagugauauuauauuc ] 5f98_C_1_D_1 5f98_I_1_J_1 [Xgacguacgucgxxxxxxxxxxxxxxxx ] 7tnz_A_1_B_1 [Xgacguacguuucgcgacuguagaxxxx ] 8g7t_A_1_E_1 [Xgaucgaucgaucgaucggcaucgaucggcxxxxgccgaucgaugccgaucgaucgaucgauccxxxx ] 8scz_A_1_B_1 [Xgaucgaucgaucguucgcgaucgaucgauccxxxx ] 8sd0_A_1_B_1 compound [M7G ] 5f98_A_1_O_1 5f98_E_1_U_1 5f98_I_1_AA_1 5f98_K_1_DA_1 [GTP ] 5f9h_A_1_Q_1 5f9h_C_1_S_1 5f9h_E_1_V_1 5f9h_G_1_Z_1 5f9h_I_1_CA_1 5f9h_K_1_FA_1 8dvr_A_1_D_1 precipitant [ETF ] 5f9f_E_1_Y_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]