Summary for the 859-th Site(R) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 859 R | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 859-th site |
STRAND: DOMAIN: /note="RLR CTR" REGION: /note="Mediates interaction with RNF135" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
G:31% N:29% R:26% K:14% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8dvs | (coil) | e (exposed) | 46.2 |
Predicted Bind Molecules |
homo:3 nucleotide:3 |
Templates for 3D complexes |
homo [94569:DDX58_HUMAN ] 5f9f_C_1_G_1 5f9h_C_1_G_1 5f9h_G_1_C_1 nucleotide [xxxxxgaucgaucgaucggcxxxxxxxxxxxxxxxxxxxxxxxxgccgaucgaucgaucxxxxxxxxx ] 7to2_A_1_B_1 [xxxxxgaucgaucgaucggcaucxxxxxxxxxxxxxxxxxxgaugccgaucgaucgaucxxxxx ] 8dvu_A_1_B_1 [xcuacagucgcgaaacguacguccxxxx ] 8g7v_C_1_F_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |