Summary for the 856-th Site(F) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 856 F | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 856-th site |
STRAND: DOMAIN: /note="RLR CTR" REGION: /note="Mediates interaction with RNF135" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
W:31% Y:29% F:26% I:14% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8dvs | (coil) | b (buried) | 0.5 |
Predicted Bind Molecules |
nucleotide:2 |
Templates for 3D complexes |
nucleotide [atctcXgXgXcaXgXgXXXXaaXgXcagXXXaaXgaXgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7mk1_B_1_D_1 [Xgacguacguuucgcgacuguagaxxxx ] 8g7u_C_1_E_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |