Summary for the 880-th Site(K) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 880 K | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 880-th site |
DOMAIN: /note="RLR CTR" REGION: /note="Mediates interaction with RNF135" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
K:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8dvs | S (bend) | e (exposed) | 64.2 |
Predicted Bind Molecules |
homo:14 nucleotide:20 |
Templates for 3D complexes |
homo [94569:DDX58_HUMAN ] 5f98_C_1_A_1 5f98_G_1_K_1 5f98_I_1_E_1 5f9f_A_1_C_1 5f9f_C_1_A_1 5f9f_G_1_K_1 5f9f_I_1_E_1 5f9h_A_1_C_1 5f9h_C_1_A_1 5f9h_G_1_K_1 5f9h_I_1_E_1 5f9h_K_1_G_1 [97281:IFIH1_MOUSE ] 7bkq_A_2_A_1 [98179:IFIH1_HUMAN ] 7jl2_E_1_C_1 nucleotide [cucuccucggcuug ] 6g19_A_1_C_1 6gjz_A_1_C_1 6gkm_A_1_C_1 7bkp_A_1_B_1 [cgucaugcgcaugga ] 6g1s_A_1_C_1 6h61_A_1_C_1 7nga_C_1_B_1 [ucuccucggcuugac ] 6gkh_A_1_C_1 7nic_A_1_C_1 [ucagucagucaguc ] 7jl0_C_1_B_1 7jl1_A_1_C_1 [ucagucagucagucuucagucagucagucuucagucagucaguc ] 7jl2_C_1_B_1 7jl2_E_1_B_1 [ucagucagucagucucagucagucagucucagucagucaguc ] 7jl3_A_1_H_1 7jl3_C_1_H_1 7jl3_E_1_H_1 [aucuccucggcuug ] 7niq_A_1_C_1 [xxxxxgaucgaucgaucggcxxxxxxxxxxxxxxxxxxxxxxxxgccgaucgaucgaucxxxxxxxxx ] 7to2_A_1_B_1 [xxxxxgaucgaucgaucggcaucxxxxxxxxxxxxxxxxxxgaugccgaucgaucgaucxxxxx ] 8dvu_A_1_B_1 [xcuacagucgcgaaacguacguccxxxx ] 8g7v_C_1_F_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |