Summary for the 791-st Site(R) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 791 R | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 791-th site |
HELIX: REGION: /note="Mediates interaction with RNF135" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
R:56% K:16% E:13% H:7% A:1% G:1% L:1% S:1% T:1% V:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8dvs | H (alpha-helix) | b (buried) | 14.2 |
Predicted Bind Molecules |
nucleotide:7 |
Templates for 3D complexes |
nucleotide [gguacguacc ] 5jaj_A_1_C_1 5jc3_D_1_E_1 5jcf_A_1_B_1 5jcf_D_1_E_1 5jch_D_1_E_1 [xggacgucaugcgcaugacgucccc ] 5jc7_A_1_C_1 [gggacgucaugcgcaugacguccc ] 5jc7_B_1_D_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |