Summary for the 790-th Site(I) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 790 I | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 790-th site |
HELIX: REGION: /note="Mediates interaction with RNF135" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
I:25% L:20% M:18% D:12% Q:7% E:7% K:7% A:1% G:1% S:1% V:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8dvs | H (alpha-helix) | e (exposed) | 40.4 |
Predicted Bind Molecules |
homo:8 nucleotide:2 |
Templates for 3D complexes |
homo [97432:D9N195_CHICK ] 5jc7_A_1_B_1 5jc7_B_1_A_1 [97281:IFIH1_MOUSE ] 7bkq_A_1_A_2 [98179:IFIH1_HUMAN ] 7jl2_G_1_C_1 [94569:DDX58_HUMAN ] 7jl3_A_1_E_1 7jl3_C_1_A_1 8g7u_A_1_C_1 8g7v_A_1_C_1 nucleotide [ucagucagucagucuucagucagucagucuucagucagucaguc ] 7jl2_C_1_B_1 7jl2_G_1_B_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |