Summary for the 702-nd Site(E)

PID QueryLength FocusSite TITLE
2752856 925 702 E RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 702-th site STRAND:
DOMAIN: /note="Helicase C-terminal"
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
E:86% R:14% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs S (bend) e (exposed) 23.6
3D Complex Information
Predicted Bind Molecules
homo:1 nucleotide:7 precipitant:3
Templates for 3D complexes
homo [94569:DDX58_HUMAN ] 4on9_A_1_B_1 nucleotide [xxxxxxxxxxxxcgacguacguccxxxx ] 7tnz_A_1_C_1 [xxxxxxxxxxxxcgacguacgucc ] 7to0_A_1_C_1 [xxxxxgaucgaucgaucggcxxxxxxxxxxxxxxxxxxxxxxxxgccgaucgaucgaucxxxxxxxxx ] 7to2_A_1_B_1 [xxxxxxxxxxxxxxxugacugcugaucagcagucacauugcccaagucucuu ] 7w0c_A_1_D_1 [ccaagucucuu ] 8hf1_A_1_H_1 8hf1_G_1_M_1 [aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa ] 8t5s_A_1_C_1 precipitant [BEF ] 5e3h_A_1_J_1 [ETF ] 5f9f_A_1_O_1 [BU3 ] 5f9f_G_1_DA_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]