Summary for the 676-th Site(P)

PID QueryLength FocusSite TITLE
2752856 925 676 P RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 676-th site HELIX:
DOMAIN: /note="Helicase C-terminal"
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
K:28% R:20% Q:9% P:8% E:7% S:6% T:4% N:3% G:3% A:2% D:2% M:2% C:1% H:1% I:1% L:1% V:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs H (alpha-helix) e (exposed) 76.0
3D Complex Information
Predicted Bind Molecules
homo:2 nucleotide:17
Templates for 3D complexes
homo [94569:DDX58_HUMAN ] 5f9f_A_1_C_1 [97281:IFIH1_MOUSE ] 7bkq_A_2_A_1 nucleotide [caagccgaggagag ] 6g19_A_1_B_1 6gjz_A_1_B_1 6gkm_A_1_B_1 7bkp_A_1_C_1 [uccaugcgcaugacg ] 6g1s_A_1_B_1 6g1x_A_1_B_1 6h61_A_1_B_1 6h66_A_1_B_1 7bkq_A_1_B_1 7bkq_A_2_B_2 7nga_C_1_A_1 [gacugacugacugaagacugacugacugaagacugacugacuga ] 7jl2_C_1_A_1 7jl2_E_1_A_1 [gucaagccgaggaga ] 7nic_A_1_B_1 [xxxxxgaucgaucgaucggcxxxxxxxxxxxxxxxxxxxxxxxxgccgaucgaucgaucxxxxxxxxx ] 7to2_A_1_B_1 [xxxxxgaucgaucgaucggcaucxxxxxxxxxxxxxxxxxxgaugccgaucgaucgaucxxxxx ] 8dvu_A_1_B_1 [gagacuugggcaaugugacugcugaucagcagucacauugcccaaguxxxxx ] 8hf0_D_1_F_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]