Summary for the 675-th Site(L) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 675 L | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 675-th site |
HELIX: DOMAIN: /note="Helicase C-terminal" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
Q:35% L:14% F:9% R:5% H:5% I:5% M:5% P:4% V:4% A:2% N:2% K:2% S:2% T:2% D:1% E:1% G:1% Y:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8dvs | H (alpha-helix) | e (exposed) | 29.2 |
Predicted Bind Molecules |
nucleotide:17 |
Templates for 3D complexes |
nucleotide [agggccgcggau ] 4gl2_A_1_F_1 4gl2_B_1_E_1 [gguagcgcuacc ] 5jbj_A_1_C_1 [gguacguacc ] 5jc3_A_1_C_1 5jc3_D_1_F_1 5jcf_D_1_F_1 5jch_A_1_C_1 5jch_D_1_F_1 [gggacgucaugcgcaugacguccc ] 5jc7_A_1_D_1 [xggacgucaugcgcaugacgucccc ] 5jc7_B_1_C_1 [agguacguacc ] 5jcf_A_1_C_1 [cgucaugcgcaugga ] 6h66_A_1_C_1 7nga_C_1_B_1 [cucuccucggcuug ] 7bkp_A_1_B_1 [agagacuugggcaaugugacugcugaucagcagucacauugcccaagucucuu ] 7w0e_C_1_A_1 [xxxxxxxxxxxxxxxxxxxxxxxxxxcagcagucacauugcccaagucucuu ] 7w0f_A_1_E_1 [uuuuuuuuuuuuuuuuuuuuuuuuuuuuuu ] 8t5s_A_1_B_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |