Summary for the 666-th Site(K)

PID QueryLength FocusSite TITLE
2752856 925 666 K RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 666-th site DOMAIN: /note="Helicase C-terminal"
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
S:14% R:13% K:13% N:11% D:11% A:7% G:7% P:6% T:5% E:4% Q:2% H:2% L:2% W:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs (coil) e (exposed) 52.4
3D Complex Information
Predicted Bind Molecules
nucleotide:27 precipitant:2
Templates for 3D complexes
nucleotide [gguacguaccc ] 5jaj_A_1_B_1 [Xguacguacccxxxx ] 5jb2_A_1_B_1 [Xgagcgugccgxxxggcacgcuccggxxxx ] 5jbg_A_1_B_1 [gguagcgcuacc ] 5jbj_A_1_B_1 [gguacguacc ] 5jc3_A_1_B_1 5jc3_D_1_E_1 5jcf_A_1_B_1 5jcf_D_1_E_1 5jch_A_1_B_1 5jch_D_1_E_1 [xggacgucaugcgcaugacgucccc ] 5jc7_A_1_C_1 [gggacgucaugcgcaugacguccc ] 5jc7_B_1_D_1 [caagccgaggagag ] 6g19_A_1_B_1 6gjz_A_1_B_1 6gkm_A_1_B_1 [uccaugcgcaugacg ] 6g1s_A_1_B_1 6g1x_A_1_B_1 6h61_A_1_B_1 7bkq_A_1_B_1 7bkq_A_2_B_2 7nga_C_1_A_1 [gucaagccgaggaga ] 6gkh_A_1_B_1 7nic_A_1_B_1 [caagccgaggagau ] 7niq_A_1_B_1 [xxxxxgaucgaucgaucggcxxxxxxxxxxxxxxxxxxxxxxxxgccgaucgaucgaucxxxxxxxxx ] 7to2_A_1_B_1 [xxxxxgaucgaucgaucggcaucxxxxxxxxxxxxxxxxxxgaugccgaucgaucgaucxxxxx ] 8dvu_A_1_B_1 [uuuuuuuuuuuuuuuuuuuuuuuuuuuuuu ] 8t5s_A_1_B_1 precipitant [BU3 ] 5f9f_C_1_T_1 [ETF ] 5f9f_E_1_Y_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]