Summary for the 645-th Site(N) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 645 N | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 645-th site |
HELIX: DOMAIN: /note="Helicase C-terminal" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
R:24% N:16% D:13% E:9% K:7% Q:6% S:6% L:5% H:4% T:3% C:2% W:2% Y:2% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8dvs | H (alpha-helix) | e (exposed) | 44.2 |
Predicted Bind Molecules |
nucleotide:4 |
Templates for 3D complexes |
nucleotide [ugagguaguagguuguauaguuuuagggxxxxxxxxxxxxxxxggagauaacuauacaaucuacugucuuacc ] 5zal_A_1_C_1 [uagcagcacauaaugguuuguggauguugxxxxggugcaggccauacugugcugccuca ] 7yym_A_1_B_1 7zpj_A_1_B_1 7zpk_A_1_B_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |