Summary for the 529-th Site(D)
PID QueryLength FocusSite TITLE
2752856 925 529 D RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 529-th site REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
D:27% S:8% G:7% L:7% V:7% K:6% T:6% N:5% Q:5% E:5% A:4% R:4% F:3% M:2% I:1% P:1% Y:1%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs S (bend) e (exposed) 75.9
3D Complex Information
Predicted Bind Molecules
nucleotide:9
Templates for 3D complexes
nucleotide [gagacuugggcaaugugacugcugaucagcagucaxxxxxxxxxxxxxxxxx ] 7w0c_A_1_C_1 [gagacuugggcaaugugacugcugaucagcagucacauugcccaagucucuu ] 7w0d_D_1_F_1 7w0d_E_1_B_1 [agagacuugggcaaugugacugcugaucagcagucacauugcccaagucucuu ] 7w0e_C_1_A_1 [xxxxxxxxxxxxxxxxxxxxxxxxxxcagcagucacauugcccaagucucuu ] 7w0f_A_1_E_1 [gagacuugggcaaugugacugcugaucagcagucacauugcccaaguxxxxx ] 8hf0_A_1_F_1 8hf0_D_1_F_1 [ccaagucucuu ] 8hf1_A_1_H_1 [gagacuugg ] 8hf1_D_1_J_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]