Summary for the 515-th Site(T) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 515 T | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 515-th site |
HELIX: REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
S:23% T:15% K:12% G:10% A:8% Q:7% L:5% F:5% I:4% R:3% N:3% V:3% D:1% E:1% P:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8dvs | H (alpha-helix) | e (exposed) | 27.3 |
Predicted Bind Molecules |
homo:1 nucleotide:8 |
Templates for 3D complexes |
homo [94569:DDX58_HUMAN ] 4on9_B_1_A_1 nucleotide [gcgcgcgcgc ] 2ykg_A_1_C_1 4bpb_A_1_C_1 [Xguacguaccxxxx ] 5jb2_A_1_C_1 [Xgagcgugccgxxxggcacgcuccggxxxx ] 5jbg_A_1_B_1 [gggacgucaugcgcaugacguccc ] 5jc7_A_1_D_1 [xggacgucaugcgcaugacgucccc ] 5jc7_B_1_C_1 [gguacguacc ] 5jch_A_1_C_1 5jch_D_1_F_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |