Summary for the 515-th Site(T)

PID QueryLength FocusSite TITLE
2752856 925 515 T RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 515-th site HELIX:
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
S:23% T:15% K:12% G:10% A:8% Q:7% L:5% F:5% I:4% R:3% N:3% V:3% D:1% E:1% P:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs H (alpha-helix) e (exposed) 27.3
3D Complex Information
Predicted Bind Molecules
homo:1 nucleotide:8
Templates for 3D complexes
homo [94569:DDX58_HUMAN ] 4on9_B_1_A_1 nucleotide [gcgcgcgcgc ] 2ykg_A_1_C_1 4bpb_A_1_C_1 [Xguacguaccxxxx ] 5jb2_A_1_C_1 [Xgagcgugccgxxxggcacgcuccggxxxx ] 5jbg_A_1_B_1 [gggacgucaugcgcaugacguccc ] 5jc7_A_1_D_1 [xggacgucaugcgcaugacgucccc ] 5jc7_B_1_C_1 [gguacguacc ] 5jch_A_1_C_1 5jch_D_1_F_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]