Summary for the 492-nd Site(D)
PID QueryLength FocusSite TITLE
2752856 925 492 D RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 492-th site REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
D:36% Q:12% S:8% K:7% R:6% G:5% H:5% N:4% E:4% L:4% I:3% A:1% F:1% P:1% T:1% V:1%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs T (Hbond turn) e (exposed) 54.3
3D Complex Information
Predicted Bind Molecules
homo:3 nucleotide:10
Templates for 3D complexes
homo [94569:DDX58_HUMAN ] 4on9_B_1_A_1 [97432:D9N195_CHICK ] 5jc7_A_1_B_1 5jc7_B_1_A_1 nucleotide [gcugaucagcagucacauugcccaagucucuu ] 7w0a_A_1_D_1 7w0a_H_1_G_1 [xxxxxxxxxxxxxxxugacugcugaucagcagucacauugcccaagucucuu ] 7w0c_A_1_D_1 [gagacuugggcaaugugacugcugaucagcagucacauugcccaagucucuu ] 7w0d_D_1_B_1 7w0d_E_1_F_1 [xgagacuugggcaaugugacugcugaucagcagucacauugcccaagucucuu ] 7w0e_C_1_B_1 [gagacuugggcaaugugacugcugauxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7w0f_A_1_F_1 [xxgacuugggcaaugugacugcugaucagcagucacauugcccaagucucuu ] 8hf0_A_1_G_1 [ccaagucucuu ] 8hf1_A_1_H_1 8hf1_G_1_M_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]