Summary for the 486-th Site(A)

PID QueryLength FocusSite TITLE
2752856 925 486 A RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 486-th site HELIX:
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
A:20% V:13% K:10% S:9% N:8% R:6% D:4% C:4% Q:4% L:4% H:3% F:3% T:3% W:3% Y:3% E:1% G:1% I:1% P:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs H (alpha-helix) b (buried) 1.8
3D Complex Information
Predicted Bind Molecules
nucleotide:3
Templates for 3D complexes
nucleotide [gagacuugggcaaugugacugcugaucagcagucaxxxxxxxxxxxxxxxxx ] 7w0c_A_1_C_1 [agagacuugggcaaugugacugcugaucagcagucacauugcccaagucucuu ] 7w0e_C_1_A_1 [xxxxxxxxxxxxxxxxxxxxxxxxxxcagcagucacauugcccaagucucuu ] 7w0f_A_1_E_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]