Summary for the 484-th Site(S)

PID QueryLength FocusSite TITLE
2752856 925 484 S RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 484-th site HELIX:
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
S:19% A:11% T:11% N:10% G:9% P:9% D:6% L:4% Y:4% R:3% C:3% Q:3% V:3% K:2% E:1% I:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs H (alpha-helix) e (exposed) 56.2
3D Complex Information
Predicted Bind Molecules
nucleotide:8
Templates for 3D complexes
nucleotide [gcugaucagcagucacauugcccaagucucuu ] 7w0a_A_1_D_1 7w0a_H_1_G_1 [xxxxxxxxxxxxxxxugacugcugaucagcagucacauugcccaagucucuu ] 7w0c_A_1_D_1 [gagacuugggcaaugugacugcugaucagcagucacauugcccaagucucuu ] 7w0d_D_1_B_1 7w0d_E_1_F_1 [xgagacuugggcaaugugacugcugaucagcagucacauugcccaagucucuu ] 7w0e_C_1_B_1 [gagacuugggcaaugugacugcugauxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7w0f_A_1_F_1 [xxgacuugggcaaugugacugcugaucagcagucacauugcccaagucucuu ] 8hf0_D_1_G_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]