Summary for the 480-th Site(R)

PID QueryLength FocusSite TITLE
2752856 925 480 R RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 480-th site HELIX:
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
R:21% K:19% Q:11% D:8% E:6% H:6% T:6% A:4% L:4% S:4% I:3% M:2% N:1% G:1% F:1% P:1% Y:1% V:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs H (alpha-helix) e (exposed) 46.2
3D Complex Information
Predicted Bind Molecules
nucleotide:9
Templates for 3D complexes
nucleotide [agagacuugggcaaugugacugcugaucagc ] 7w0a_A_1_C_1 7w0a_H_1_F_1 [gagacuugggcaaugugacugcugaucagcagucaxxxxxxxxxxxxxxxxx ] 7w0c_A_1_C_1 [gagacuugggcaaugugacugcugaucagcagucacauugcccaagucucuu ] 7w0d_D_1_F_1 [agagacuugggcaaugugacugcugaucagcagucacauugcccaagucucuu ] 7w0e_C_1_A_1 [xxxxxxxxxxxxxxxxxxxxxxxxxxcagcagucacauugcccaagucucuu ] 7w0f_A_1_E_1 [gagacuugggcaaugugacugcugaucagcagucacauugcccaaguxxxxx ] 8hf0_A_1_F_1 [gagacuugg ] 8hf1_A_1_E_1 8hf1_G_1_L_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]