Summary for the 425-th Site(D) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 425 D | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 425-th site |
HELIX: DOMAIN: /note="Helicase ATP-binding" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
D:30% E:24% Q:10% N:6% I:5% A:4% L:4% K:4% S:4% T:3% R:1% G:1% P:1% V:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8dvs | H (alpha-helix) | e (exposed) | 60.5 |
Predicted Bind Molecules |
homo:4 nucleotide:1 |
Templates for 3D complexes |
homo [97432:D9N195_CHICK ] 5jc7_A_1_B_1 5jc7_B_1_A_1 [103072:A1ZAW0_DROME ] 7w0a_A_1_H_1 7w0a_H_1_A_1 nucleotide [xxxxxxxugagccaaaaguucaggugaaugaugccuggcucgagaccauucaaucucaugxxxxxxxxxxuauxxxgaxgaugxugaugaugucggaccaggcuucauuccccucaacuuxxxxxxxuugcxxcucaaucxxxxxxxx ] 7eld_A_1_B_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |