Summary for the 416-th Site(D) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 416 D | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 416-th site |
DOMAIN: /note="Helicase ATP-binding" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
D:28% K:16% G:13% S:8% A:5% T:5% E:4% I:4% P:4% V:4% R:3% H:2% L:2% N:1% Q:1% F:1% Y:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8dvs | S (bend) | e (exposed) | 77.8 |
Predicted Bind Molecules |
homo:1 nucleotide:2 |
Templates for 3D complexes |
homo [94569:DDX58_HUMAN ] 8g7v_A_1_C_1 nucleotide [Xgaucgaucgaucgaucggcaucgaucggcxxxxgccgaucgaugccgaucgaucgaucgauccxxxx ] 8scz_A_1_B_1 [aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa ] 8t5s_A_1_C_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |