Summary for the 322-nd Site(T) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 322 T | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 322-th site |
STRAND: DOMAIN: /note="Helicase ATP-binding" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
T:16% A:15% K:10% C:8% G:8% S:8% V:6% I:5% L:5% Q:4% F:4% R:3% E:3% Y:2% D:1% W:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8dvs | E (beta-strand) | e (exposed) | 21.4 |
Predicted Bind Molecules |
homo:18 nucleotide:2 |
Templates for 3D complexes |
homo [94569:DDX58_HUMAN ] 5f98_A_1_C_1 5f98_C_1_A_1 5f98_E_1_I_1 5f98_G_1_K_1 5f98_I_1_E_1 5f98_K_1_G_1 5f9f_A_1_C_1 5f9f_C_1_A_1 5f9f_E_1_I_1 5f9f_G_1_K_1 5f9f_I_1_E_1 5f9f_K_1_G_1 5f9h_A_1_C_1 5f9h_C_1_A_1 5f9h_E_1_I_1 5f9h_G_1_K_1 5f9h_I_1_E_1 5f9h_K_1_G_1 nucleotide [xxxxxxxugagccaaaaguucaggugaaugaugccuggcucgagaccauucaaucucaugxxxxxxxxxxuauxxxgaxgaugxugaugaugucggaccaggcuucauuccccucaacuuxxxxxxxuugcxxcucaaucxxxxxxxx ] 7eld_A_1_B_1 [gagacuugggcaaugugacugcugaucagcagucacauugcccaagucucuu ] 7w0d_E_1_B_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |