Summary for the 234-th Site(D) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 234 D | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 234-th site |
REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
D:39% T:17% P:14% N:7% Q:7% S:6% A:5% R:1% E:1% G:1% I:1% L:1% K:1% V:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8dfv | T (Hbond turn) | e (exposed) | 48.8 |
Predicted Bind Molecules |
nucleotide:1 |
Templates for 3D complexes |
nucleotide [ugagguaguagguuguauaguaguaauuacacaucauacuauacaaccuacuaccucucu ] 8dfv_A_1_B_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |