Summary for the 65-th Site(R) |
PID | QueryLength | FocusSite | TITLE |
2690321 | 904 | 65 R | RecName: Full=Toll-like receptor 3 ;AltName: CD_antigen=CD283;Flags: Precursor; |
AC/ID | AC:O15455 ID:TLR3_HUMAN |
Feature Table for 65-th site |
REPEAT: /note="LRR 1" VAR_SEQ: /note="Missing (in isoform 2)" /id="VSP_054188" TOPO_DOM: /note="Lumenal" CHAIN: /note="Toll-like receptor 3" /id="PRO_0000034715" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
G:17% R:12% S:11% E:9% T:9% K:8% A:6% N:5% H:5% V:5% D:3% Q:3% L:2% M:2% C:1% I:1% F:1% Y:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7c76 | (coil) | e (exposed) | 58.1 |
Predicted Bind Molecules |
hetero:10 homo:2 nucleotide:11 compound:22 precipitant:1 |
Templates for 3D complexes |
hetero [30263 ] 7p5v_A_1_G_1 7p5v_B_1_H_1 7p5v_C_1_I_1 7p5v_D_1_J_1 7p5v_E_1_K_1 7p5v_F_1_L_1 8b41_A_1_G_1 8b41_B_1_H_1 8b41_C_1_I_1 8b41_D_1_J_1 homo [79435:F2YBL9_ANOGA ] 4xgo_A_1_B_1 4xgo_B_1_A_1 nucleotide [aggcgtttttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5zln_A_1_C_1 5zln_B_1_D_1 [xxxxxxxxugaaggccuguuuccuaggcuacauacgagggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgcaccaaccacacggggcucauucucagcgcxxx ] 7das_A_1_C_1 [aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaauuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu ] 7wm4_B_1_E_1 [XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX ] 7wv3_C_1_F_1 [XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX ] 7wv5_A_1_D_1 7wve_A_1_D_1 7wvf_A_1_D_1 [cccccccccccccccccccccccccccccccccccccccccccccc ] 7wv5_B_1_C_1 7wve_B_1_C_1 7wvf_B_1_C_1 compound [NAG ] 3ulv_A_1_N_1 3w3n_B_1_W_1 3wn4_A_1_G_1 3wn4_A_2_G_2 4r07_A_1_U_1 4r08_A_1_T_1 4r0a_A_1_G_1 4r0a_A_2_G_2 4z0c_A_1_S_1 4z0c_B_1_DA_1 5awd_A_1_F_1 5awd_A_2_F_2 5wyx_B_1_O_1 6v9u_A_1_I_1 6zjz_A_1_L_1 7crf_A_1_T_1 7crf_B_1_EA_1 7rc9_A_1_I_1 7rc9_B_1_Q_1 7wm4_A_1_IA_1 7wm4_B_1_KA_1 7wm4_D_1_QA_1 precipitant [SO4 ] 3wpc_A_1_M_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |